AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |
Back to Blog
Clc sequence viewer download12/16/2023 For the sequencing run, the final pooled library of small RNAs consisted of 2 samples. All the kits were used according to the manufacturers’ instructions. The quality and quantity of the library were determined using an Agilent High Sensitivity DNA Kit (Agilent, Santa Clara, CA, USA). The small RNA library was constructed using a NEBNext ® Small RNA Library Prep Set (NEB, Ipswich, UK) and purification was conducted with a TailorCut Gel Extraction Tool Set (SeqMatic, Fremont, CA, USA). The amount and quality of RNA were determined using an Agilent Small RNA kit (Agilent, Santa Clara, USA), and the precise concentration was measured using a Modulus™ Single Tube Multimode Reader (Turner Biosystems, Sunnyvale, CA, USA). The same RNA as for real-time RT-PCR detection was used for small RNA sequencing. Simultaneously, the internal positive control RT-qPCR test was performed in a separate reaction using the primers and probe to detect the plant cytochrome oxidase gene (COX-F: CGTCGCATTCCAGATTATCCA, COX-R: CAACTACGGATATATAAGAGCCAAAACTG, COX-P: HEX-TGCTTACGCTGGATGGAATGCCCT-BHQ1) under the same reaction conditions to check the quality and quantity of the extracted RNA. During the test validation in the laboratory, the experimental Ct cut-off value was set to 34. The reaction was performed in a StepOnePlus Real-Time PCR System (Applied Biosystems) under the following reaction conditions: reverse transcription for 10 min at 55 ☌ initial denaturation for 1 min at 94 ☌ and 45 cycles of 10 s at 94 ☌ denaturation and 1 min of 60 ☌ extension. The total volume of 10 µL of the reaction mix contained 1× Luna Universal Probe One-Step Reaction Mix (New England Biolabs), 0.3 µM of each primer (CaTa28 F: GGTGGTGTCAGTGTCTGTTT, CaTa28 R: GCGTCCTTGGTAGTGATGTT), 0.2 µM of the probe (CaTa28 P: FAM-AGAGAATGGAGAGAGCGGACGAGG-BHQ1), and 2 µL of the undiluted RNA extract. Ī one-step real-time RT-PCR using CaTa28 primers and probes developed by ISHI-Veg was performed to detect the virus. miRNAs can hold a negative or positive role in virus-related processes in three manners as follows: direct binding to the viral genome binding to viral transcripts or binding to host transcripts. Even if the base pairing between the miRNA and its target messenger RNA (mRNA) does not match perfectly, the seed sequence must always be perfectly complementary. Perfect binding in the seed region has a major impact on the regulatory function of a miRNA. The seed sequence or seed region in miRNA is represented by a conserved heptametrical sequence. Perfect binding in the seed region has a major impact on the regulatory functions of a miRNA. Viral replication and proliferation included in host antiviral responses and the pathogenesis of the virus may be influenced by miRNAs. Small noncoding RNAs called microRNAs (miRNAs) play an important role in posttranscriptional gene regulation related to diverse biological processes, including development, immune system responses, and cell death. The genome of ToBRFV is ~6.4 nt long and has four open reading frames, 183 kDa and 126 kDa replication proteins, a movement protein (MP), a coat protein (CP), and 5′ and 3′ untranslated regions. There is no known resistance to ToBRFV, even in cultivars previously resistant to other tobamoviruses. ToBRFV was detected in the Czech Republic for the first time in 2020 ( -accessed 29 November 2022). The spread of the virus has accelerated, representing a major economic concern, which has consequently led to phytosanitary regulation in the EU. The occurrence of ToBRFV in tomato-production areas was confirmed in the USA (California and Florida), China, Iran, Israel, Jordan, Saudi Arabia, Syria, Turkey, the United Kingdom, and in many EU countries, such as Italy, Germany, Greece, the Netherlands, Belgium, Poland, and Austria. ToBRFV was initially detected in Jordan and Israel in 20, respectively, and recently it has been detected in tomato-production areas worldwide. Pepper can be also infected by ToBRFV and eggplant is considered an unconfirmed host. Except for tomato mosaic virus (ToMV) and tobacco mosaic virus (TMV) that are the most commonly spread, there is a new threat, namely the tomato brown rugose fruit virus (ToBRFV) (Martellivirales Virgaviridae Tobamovirus), a recently described tobamovirus first detected in the Middle East. Tobamoviruses are mechanically transmitted plant viruses that cause severe economic damage to vegetables worldwide.
0 Comments
Read More
Leave a Reply. |